Non-standard Join Certificates: Human Build 34 (July 2003)   Accession 1 Accession 2 Spanner Variation Variation Evidence Comment Evaluation Remark Contact AL606514 AL627107   sine none Alu. Deletions in alu repeats in both clones disrupting join. There is one BAC End which supports the join RPCI-456B9. Also looking at the actual size of the overlaps between AL627107 and AL606514, the total overlap in unsubmitted sequence is 86688bp. AL627107 also actualy overlaps AL139326 (the clone after AL606514 in the TPF) by about 50Kb, but as AL606514 was finished first, it remained in the TPF. pass Would be better to have BAC, fosmid end support or other, but extensive overlap from unsubmitted sequence is a good proxy. It seems that the clone AL606514 may be unnecessary to have in TPF if AL527107 overlaps AL139326. [email protected] AP002529 AP002530 AL359174     Blunt end join submitted by JST spanned by AL359174.14 and 10 BAC, 4 fosmid end pairs. pass   [email protected] AP002530 AP002531 AL355532     Blunt end join submitted by JST spanned by AL355532.10 and 7 BAC, 3 fosmid end pairs. pass   [email protected] AL008729 AL391385   sslp Not experimental 100bp overlap. Join supported by 4 BACs and 4 Fosmids. Half dovetail; misses other side by 19bp as a result of a 9bp polyA indel. AL391385.8 has (A)31; AL008729.1 has (A)22. pass   [email protected] AL034346 AL499606   other Not experimental 2000bp overlap. Variations clustered in the tandem repeat of the overlap. Half dovetail; misses other side by 145bp. 14 copies of 34bp repeat in AL499606.18; 25 copies of 34bp repeat in AL034346.31. Join supported by 10 BAC and 1 fosmid end pairs. return requires additional support eg. PCR [email protected] AL096678 AL159174   sslp Not experimental 2082bp overlap. 464bp deletion in AL096678.8 which includes (CA)n and (TA)n. Join supported by 11 BACs and 6 fosmids pass   [email protected] AL109940 AL442124   other Not experimental 100bp overlap +/+ orientation. 51bp tandem repeat causing assembly trouble. 20 copies in AL109940 and 40 copies in AL442124. Join supported by 5 BAC and 8 fosmid end pairs. return requires additional support eg pcr. [email protected] AL357058 AP002528       Preferential use of Sanger sequence (AL357058) to JST sequence (AP002528.1) pass This is a unique situation, with one clone contained entirely within another. This is not really a bad join, but a substitution of part of a project with another. Pass, as discussed with GS and AJM. [email protected] AL445250 AL591624   sslp Not experimental 110369bp overlap. 474 bp deletion in AL445250: 180bp (TATAA)n Simple_repeat, 200bp (TTATA)n Simple_repeat and 61bp AT_rich Low_complexity repeat. Join supported by 4 pairs of BAC ends and 2 pairs of fosmid ends pass   [email protected] AL591046 AL591073   other Not experimental 101450bp overlap. Join supported by 3 pairs of BAC ends. return Extensive overlap, but missing information. Please describe variation [email protected] AL591480 AL596449   other Not experimental 32827bp overlap. 10377bp deletion in AL596449.4. Join supported by 12 BAC and 6 fosmid end pairs. return requires additional support eg pcr. [email protected] AL133255 AL591044 AL596216     Overlap of 6bp at GAATTC cloning site. Join supported by PCR product sequence AL596216.1 and 2 pairs of BAC and fosmid ends. pass   [email protected] AB000878 AC006046       This is the boundary between Inoko MHC class I and the class III here represented by Geraghty sequence, overlap is 18554bp pass probably OK, given region and extensive overlap. More BAC/fosmid end support might be useful. Fairly unique situation. [email protected] AB000878 AB000879 AP000506     MHC class I. Overlap of 4bp restriction site (GATC). Join supported by 4 BAC, 3 fosmid end pairs. pass   [email protected] AB000879 AB000880 AP000507     MHC class I. Overlap of 4bp restriction site (GATC). Join supported by 2 BAC, 1 fosmid end pairs. pass   [email protected] AB014077 AB023052 AP000513     MHC class I. Overlap of 4bp restriction site (GATC). Join supported by 4 BAC, 8 fosmid end pairs. pass   [email protected] AB014077 AB014078 AP000514     MHC class I. Overlap of 4bp restriction site (GATC). Join supported by 8 BAC, 5 fosmid end pairs. pass   [email protected] AB014078 AB014079 AP000514     MHC class I. Overlap of 4bp restriction site (GATC). Join supported by 8 BAC, 4 fosmid end pairs. pass   [email protected] AB014079 AB014080 AP000514     MHC class I. Overlap of 4bp restriction site (GATC). Join supported by 8 BAC, 2 fosmid end pairs. pass   [email protected] AB014080 AB014081 AP000514     MHC class I. Overlap of 4bp restriction site (GATC). Join supported by 8 BAC, 4 fosmid end pairs. pass   [email protected] AB014081 AB014082 AP000514     MHC class I. Overlap of 4bp restriction site (GATC). Join supported by 7 BAC, 6 fosmid end pairs. pass   [email protected] AB014082 AB014083 AP000515     MHC class I. Overlap of 4bp restriction site (GATC). Join supported by 9 BAC, 7 fosmid end pairs. pass   [email protected] AB014083 AB014084 AP000515     MHC class I. Overlap of 4bp restriction site (GATC). Join supported by 9 BAC, 4 fosmid end pairs. pass   [email protected] AB014084 AB014085 AP000515     MHC class I. Overlap of 4bp restriction site (GATC). Join supported by 8 BAC, 5 fosmid end pairs. pass   [email protected] AB014085 AB014086 AP000516     MHC class I. Overlap of 4bp restriction site (GATC). Join supported by 9 BAC, 7 fosmid end pairs. pass   [email protected] AB014086 AB014087 AP000516     MHC class I. Overlap of 4bp restriction site (GATC). Join supported by 7 BAC, 8 fosmid end pairs. pass   [email protected] AB014087 AB014088 AP000516     MHC class I. Overlap of 4bp restriction site (GATC). Join supported by 8 BAC, 4 fosmid end pairs. pass   [email protected] AB014088 AB023053 AP000516     MHC class I. Overlap of 4bp restriction site (GATC). Join supported by 9 BAC, 5 fosmid end pairs. pass   [email protected] AB023048 AB023060 AP000510     MHC class I. Overlap of 4bp restriction site (GATC). Join supported by 4 BAC, 8 fosmid end pairs. pass   [email protected] AB023048 AB023050 AP000511     MHC class I. Overlap of 6bp restriction site (AAGCTT). Join supported by 3 BAC, 9 fosmid end pairs. pass   [email protected] AB023049 AB023051 AP000512     MHC class I. Overlap of 6bp restriction site (AAGCTT). Join supported by 5 BAC, 3 fosmid end pairs. pass   [email protected] AB023049 AB023052 AP000513     MHC class I. Overlap of 4bp restriction site (GATC). Join supported by 4 BAC, 5 fosmid end pairs. pass   [email protected] AB023050 AB023051 AP000512     MHC class I. Overlap of 4bp restriction site (GATC). Join supported by 3 BAC, 3 fosmid end pairs. pass   [email protected] AB023053 AB023055 AP000517     MHC class I. Overlap of 4bp restriction site (GATC). Join supported by 8 BAC, 4 fosmid end pairs. pass   [email protected] AB023056 AB023057 AP000520     MHC class I. Overlap of 4bp restriction site (GATC). Join supported by 5 BAC, 5 fosmid end pairs. pass   [email protected] AB023059 D84394 AP000509     MHC class I. Overlap of 6bp restriction site (GAATTC). Join supported by 5 BAC, 2 fosmid end pairs. pass   [email protected] AB023059 AB023060 AP000509     MHC class I. Overlap of 4bp restriction site (GATC). Join supported by 3 BAC, 2 fosmid end pairs. pass   [email protected] AC003098 AC015937   sslp Blast2 and RepeatMasker AC003098 contains 22bp more of sslp at bp 93315. PAC/CIT. 2000 bp total overlap. 2 supporting fosmids pass   [email protected] AC003976 AC069363   sslp Blast2 and RepeatMasker AC003976 has a 172 bp deletion in a (GAAA)n repeat. RP11/CIT libraries 58000 bp overlap. 11 supporting fosmids. pass 11 fosmid ends - is this overrepresentation? Please comment. [email protected] AB020862 AB020863 AC079187     6 supporting BACs, 2 supporting fosmids. pass   [email protected] AC004707 AC015909   sine Blast2 and RepeatMasker AC015909 contains 384 bp inserted region containing Alu and simple repeat (TGAA)n. RP11/PAC. Total 51000 bp overlap 1 supporting Bac; 11 supporting fosmids. pass Concern re over-representation of 11 pairs fosmid ends. Please comment. [email protected] AC004585 AC018629   sine Blast2 and RepeatMasker AC004585 contains 571 bp inserted region containing Alu, FLAM_C, and simple repeat (TTCC)n. RP11/PAC Total 5500 bp overlap 3 supporting Bacs; 2 supporting fosmids. pass multiple variations-probably better to confirm polymorphism [email protected] AC006050 AC090685   sslp Blast2 and RepeatMasker AC006050 missing 312 bases within a (TATATG)n repeat. RP11/PAC 81000 bp total overlap,6 Bacs; 5 supporting fosmids. pass   [email protected] AC006251 AC015922   sslp Blast2 and RepeatMasker AC006251 has a 4217 bp deletion(126811..131028). CIT/PAC 38000 bp total overlap. 5 Bacs; 4 fosmids support join. pass   [email protected] AC007632 AC023394   sslp repeatmasker and human analysis TA simple repeat region is ~250bp longer in AC023394; join is supported by high % identity across the overlap and 1 fosmid and 6 BACs which link across the join pass   [email protected] AC009277 AC068506   other sequence alignment; to be tested duplication of 289bp in AC009277; perfect repeat; join is supported by high % identity across the overlap and 5 pairs of fosmid end seq and 6 pairs of BAC end seq which link across the join return Requires additional support, eg PCR [email protected] AC009285 AC087224   sslp   ID is 99.53 (below threshold of 99.60) in 28kb ol. Areas of low ID are accounted for as SSLPs in simple repeat areas. Join supported by 1 BAC and 7 fosmids. pass   [email protected] AC009455 AC079062   sslp repeat masker, sequence alignment TA simple repeat region is ~200bp longer in AC079062; join supported by 4 BACs which link across join. Total overlap 41kb. pass   [email protected] AC011120 AC080037   sine Blast2 and RepeatMasker AC011120 contains inserted AluJo not present in AC080037. Total 142000 bp overlap 6 supporting Bacs; 19 supporting fosmids. return is 19 fosmid-ends overrepresentation? Please comment. [email protected] AC011825 AC015563   other to be tested 189bp deletion in AC015563; join is supported by high % identity across the overlap and 5 pairs fosmid end seq and 4 pairs of BAC end seq which link across the join return Requires additional support, eg PCR [email protected] AC012213 AC069351   sine Global Sequence Alignment and RepeatMasker 40 kb overlap. Break in alignment is caused by 310 bp AluY insertion in AC069351. 3 supporting BACs, 11 supporting fosmids. pass   [email protected] AC012238 AC023926   line Global Sequence Alignment and RepeatMasker 33 kb overlap. Break in alignment is a result of 299 bp L1PA4 insertion in AC023926. 3 supporting BACs, 2 supporting fosmids. pass   [email protected] AC013290 AC022601   sine repeatmasker break in alignment caused by ~286bp insertion of AluY SINE/Alu element in AC022601; join is supported by high % identity across the overlap and 1 pair of fosmid end seq and 6 pairs of BAC end seq which link across the join pass   [email protected] AC015691 AC109341   sslp Global Sequence Alignment, RepeatMasker 61kb overlap, MIR and AT-rich, supported by 6 pairs of BAC ends, 4 pairs of fosmid ends. pass   [email protected] AC015700 AC100763   line RepeatMasker, Global Sequence Alignment 105kb overlap, L1PA3 in AC015700`s 75649- 75828, supported by 2 pairs of BAC ends, 4 pairs of fosmid ends pass   [email protected] AC015884 AC016292   sslp Blast2 and RepeatMasker AC015884 contains ~6 more copies of a 30bp repeat 41662 bp total overlap 3 supporting bacs, 7 supporting fosmids pass   [email protected] AC015884 AC036164   sslp Blast2 and RepeatMasker AC015884 contains 1029 bp inserted region containing ~16 more copies of a 65 bp repeat. Found at bp 316-1344 (GGGGGGGGCTGGAGTCAGAGAGACCAAGGTTGGAACCCGGC AGGTACCACGGACGGTCACACTGT) AC015884 contains 388 bp inserted region containing same repeat element as above. Bp 1870-2257 9300 bp total overlap 3 supporting bacs, 4 supporting fosmids. pass   [email protected] AC015921 AC097370   other Blast2 and RepeatMasker AC015921 contains inserted region of 467 bp. 14790 total overlap. 1 supporting Bac, 4 supporting fosmids return requires additional support (eg pcr). [email protected] AC016888 AC064805   sslp Blast2 and RepeatMasker AC016888 contains 120 bp deletion in MER4A element. 49000 bp total overlap, 3 supporting Bacs; 4 supporting fosmids. pass   [email protected] AC018943 AC108137   other BLAST2, Global Sequence Alignment, RepeatMasker AC018943 contains 193 bp insertion that is not present in AC108137. Total overlap is 23 Kb, 5 supporting BACs, 9 supporting fosmids return Probably OK, but requires additional confirmation of insertion polymorphism [email protected] AC021553 AC100825   line BLAST2, Global Sequence Alignment, RepeatMasker AC021553 contains 231 bp of a LINE/L2 element not present in AC100825. Total overlap is 26Kb, 1 supporting BAC, 1 supporting fosmid. pass   [email protected] AC021594 AC068473   other human analysis and sequence alignment Insertion of a ~180bp of a 38bp repetive element in AC068473. Join supported by 3 BACs and 10 fosmids. Total overlap 48kb. pass is 12 pairs fosmid-ends overrepresentation? Comment please. [email protected] AC021760 AC040926   sslp BLAST2, Global Sequence Alignment overlap of 10kb. SSLP 121bp longer in AC021760. 12 supporting BACs. pass is 12 pairs BAC-ends overrepresentation? [email protected] AC022558 AC044907   line BLAST2, Global Sequence Alignment, RepeatMasker AC044907 contains 6,031 bp of a LINE/L1HS element not present in AC022558. Total overlap is 49Kb, 5 supporting BACs, 7 supporting fosmids. pass   [email protected] AC022596 AC098850   sine Blast2 and RepeatMasker AC022596 contains inserted Alu not present in AC098850. Total 120000 bp overlap, 4 supporting Bacs; 18 supporting fosmids. return is 18 pairs fosmid-ends overrepresentation? Please comment. [email protected] AC024474 AC061965   sslp BLAST2, Global Sequence Alignment, RepeatMasker AC061965 contains 559 bp of C-rich, (CACCT)n, (CACCC)n elements not present in AC024474. Total overlap is 9Kb, 4 supporting BACs, 3 supporting fosmids pass   [email protected] AC024610 AC078907   sslp Blast2 and RepeatMasker AC078907 missing 258 bases within a (TAG)n repeat. 54000 bp total overlap 5 supporting Bacs; 20 supporting fosmids. return is 20 fosmid-ends overrepresentation? Please comment. [email protected] AC025519 AC053479   sslp BLAST2 and RepeatMasker 94 kb overlap. Break in alignment is caused by a 286 bp (TA)n insertion in AC053479. 2 supporting BACs, 3 supporting fosmids. pass   [email protected] AC025521 AC100832   sine Blast2 and RepeatMasker AC100832 contains 217 bp inserted region containing Alu. 33000 bp total overlap 3 supporting BACS and 1 supporting fosmid. pass   [email protected] AC025787 AC109635   sslp Global Sequence Alignment, RepeatMasker 116kb overlap, (TA)n (TAA)n SSLP, supported by 3 pairs of BAC ends, 4 pairs of fosmid ends pass   [email protected] AC026636 AC104938   other BLAST2, Global Sequence Alignment, RepeatMasker There are 2 ins/del in this overlap: AC026636 contains 360 bp of a LINE/L2 element that is not present in AC104938, and AC104938 contains 133 bp of a SINE/Alu/AluJo element that is not present in AC026636. Total overlap is 36 Kb, 4 supporting BACs, 7 supporting fosmids. AC026636 is from the RP11 library, AC104938 is from the CTD library pass   [email protected] AC026991 AC087367   sslp BLAST2, Global Sequence Alignment overlap of 59kb. SSLP 311bp longer in AC026991. 3 supporting BACs, 5 supporting fosmids. pass   [email protected] AC036164 AC087392   sslp Blast2 and RepeatMasker AC087392 contains 354bp inserted region at bp 16581. AC036164 contains 330 bp more of a (GGTTG)n repeat at bp 68475. 30896 bp total overlap. 7 supporting bacs, 4 supporting fosmids. pass   [email protected] AC036196 AC103858   other BLAST2, Global Sequence Alignment, RepeatMasker AC103858 has 995 bp region (containing L2 and MER elements) flanked by two AluSx elements, while in the analogous region of AC036196 there is only one AluSx element and not the L2 and MER elements. Total overlap is 47Kb, 7 supporting BACs, 2 supporting fosmids. return multiple complex `other` requires confirmation of polymorphism eg by PCR [email protected] AC044814 AC107934   other BLAST2, Global Sequence Alignment overlap of 147kb. 173bp tigger2 insertion in AC107934. 5 supporting BACs, 2 supporting fosmids. pass   [email protected] AC055854 AC105046   sslp BLAST2, Global Sequence Alignment overlap of 33kb. SSLP 325bp longer in AC055854. 3 supporting BACs, 6 supporting fosmids. pass   [email protected] AC083845 AC103760   line Global Sequence Alignment and RepeatMasker 43 kb overlap. Break in alignment is caused by a 28 bp (T)n and 109 bp L1HS insertion in AC083845. 1 supporting fosmid. pass   [email protected] AC083973 AC107885   other Global Sequence Alignment, RepeatMasker, Blast2 overlap of 56kb. Two breaks in alignment caused by 311bp SINE insertion in AC083973 and 479bp insertion of SINE LINE SINE in AC083973. 4 supporting BACs, 5 supportings fosmids. pass Probably OK, but multiple problems may warrant confirmation of haplotypes [email protected] AC084125 AF186192   other Global Sequence Alignment and RepeatMasker 17 kb overlap. Two breaks in the alignment. One is caused by a low complexity GC-rich region which is 967 bp longer in AF186192. The other is caused by multiple Alu and AluJ/FRAM repeats (767 bp) in AC084125 while the corresponding region in AF186192 has multiple AluSg/x repeats (567 bp). 1 supporting BAC, 4 supporting fosmids. CTD clone and RP4 clone libraries return This multiple variation is actually quite interesting, but should be confirmed as a polymorphism by pcr. [email protected] AC087269 AC090567   other Global Sequence Alignment, RepeatMasker, Blast2 overlap of 32kb. 166bp LTR12C insertion in AC090567. 3 supporting BACs, 6 supporting fosmids. pass   [email protected] AC087399 AC087675   other sequence alignment and human analysis Insertion of ~500bp made of an 80bp repetetive element in AC087399. Insertion of ~240bp in AC087675. Join supported by 4 BACs and 3 fosmids. Total overlap 97kb. return multiple `other` (insertions) requires additional support (eg pcr) [email protected] AC087516 AC103988   sine BLAST2, Global Sequence Alignment, RepeatMasker AC103988 contains 313 bp of AluSx and AluY elements not present in AC087516. Total overlap is 57Kb, 10 supporting BACs, 5 supporting fosmids. pass   [email protected] AC087675 AC109314   sslp repeat masker AT-rich region. Join supported by 2 BACs and 1 fosmid. Total overlap 42kb. pass   [email protected] AC087691 AC107993   other Blast2 and RepeatMasker AC087691 contains 240 bp inserted region containing MSR1 satellite elements 37000 bp total overlap 6 supporting Bacs; 2 supporting fosmids. pass   [email protected] AC090354 AC090396   other sequence alignment and human analysis There is a ~500bp segment of sequence that is repeated once more in AC090396 than in AC090354. 6 BACs and 5 fosmids confirm join. Total overlap 116kb. pass   [email protected] AC090377 AC107990   sine sequence alignment break in alignment caused by 946bp insertion in AC107990 (contains a AluJb and AluY), Overlap confirmed with AP001549 which does not contain the insertion. 5 pairs of fosmid end seq and 3 pairs of BAC end seq link across this join) pass   [email protected] AC090592 AC100770   other RepeatMasker, Global Sequence Alignment 125kb overlap, LTR33 repeated in AC090592, supported by 2 pairs of fosmid ends. Draft AC025235 supports join. pass   [email protected] AC090639 AC107925   sslp Global Sequence Alignment 61kb overlap, (AT)n, AT-rich, supported by 4 pairs of BAC ends, 2 pairs of fosmid ends pass   [email protected] AC090691 AC100797   other Global Sequence Alignment, RepeatMasker, Blast2 overlap of 57kb. Break in alignment caused by imperfect 28mer repeat ("CCCCTCGGCGAGGACAGAGGCGCGGCGG ") that is 770bps larger in AC090691. 2 supporting BACs, 6 supporting fosmids. pass   [email protected] AC090796 AC091561   sslp BLAST2, Global Sequence Alignment overlap of 111kb. SSLP 317bp longer in AC090796. 3 supporting BACs, 2 supporting fosmids. pass   [email protected] AC090970 AC090971   other repeat masker SINE/other. broken overlap caused inserted region of three Charlie1 elements with two intervening AluSx elements (Charlie1- AluSx- Charlie1- AluSx- Charlie1), 1,037 bp total, in AC090970; join is supported by high % identity across the 117 kb overlap and 12 fosmids which link across the join. return is 12 pairs fosmid-ends overrepresentation? Please comment. [email protected] AC091010 AP003480   sslp BLAST2 and RepeatMasker 58 kb overlap. Break in alignment is caused by a 342 bp (TAAA)n insertion in AC091010. 7 supporting BACs, 3 supporting fosmids. pass   [email protected] AC091170 AC100778   sine repeatmasker ~300bp AluYa5 element present in AC100778. TA simple repeat region is ~300bp longer in AC100778. join is supported by high % identity across the overlap, 1 BAC & 5 fosmids. Total overlap 79kb. pass   [email protected] AC079073 AC104042   sine RepeatMasker, Global Sequence Alignment 44kb overlap, AluSx insertion in AC104042, supported by 7 pairs of BAC ends, 5 pairs of fosmid ends pass   [email protected] AC079200 AC112673   line BLAST2, Global Sequence Alignment overlap of 18kb. 354bp LINE insertion in AC112673. 6 supporting BACs, 6 supporting fosmids. pass   [email protected] AC102802 AC103952   other Global Sequence Alignment, RepeatMasker, Blast2 overlap of 41kb. Two breaks in alignment caused by 4110bp insertion in AC103952 and 321bp insertion in AC102802 containing SINE. 2 supporting BACs, 1 supporting fosmid. return multiple, insertion probably requires additional confirmation [email protected] AC103834 AC103877   sine BLAST2, Global Sequence Alignment overlap of 38kb. 283bp Alu insertion in AC103834. 6 supporting BACs, 3 supporting fosmids. pass   [email protected] AC104038 AC107881   sslp Global Sequence Alignment, RepeatMasker 95kb overlap, SSLP (CACCC)n (CCA)n, supported by 8 pairs of BAC ends, 12 pairs of fosmid ends pass is 12 pairs fosmid-ends overrepresenataion? [email protected] AC104989 AC105029   sslp BLAST2, Global Sequence Alignment overlap of 32kb. SSLP 294bp longer in AC104989. 3 supporting fosmids. pass   [email protected] AC105110 AC108452   other sequence alignment inversion of ~2240bp in the overlap region; join is supported by high % identity across the overlap 10 pairs of fosmid end seq and 2 pairs of BAC end seq which link across the join return Requires additional support, eg PCR [email protected] AC105142 AC107877   other BLAST2 18 kb overlap. Break in alignment is caused by a 249 bp insertion in AC107877. 8 supporting BACs and another supporting finished accession (AP004710). return Insertion requires futher support as being polymorphic [email protected] AC110288 AF067845   other Global Sequence Alignment and RepeatMasker other and SSLP. 26 kb overlap. Six breaks in the alignment. 1. Low complexity region is 616 bp longer in AF067845. 2.(GT)n repeat is 677 bp longer in AF067845. 3. AC110288 has an extra copy of a GGAGGAGAAACGTGGCAGGCGTGAACAGACACCACGTGAGAC repeat. 4. AF067845 has an extra copy of a CACGTGAGACAGGGAGGAGAAACGTGGCAGGCGTGAACAGA repeat. 5. AF067845 has an extra copy of a ATTTTCTGTGAGTTCCCGAGCTCTGCTCCACACCTGGGACCG GACTCGGAATTTTCTGTGAGTTCCCGAGCTCTGCTCCATACC TGGGACCGGACTCAGC repeat. 6. poly A region is 11 bp longer in AC110288. 1 supporting BAC test seq, 1 supporting draft (AC141072), 5 supporting fosmids. CTD clone versus P1 clone. return Multiple `other`, requires additional support eg. PCR [email protected] AC019257 AC100810   other Global Sequence Alignment, RepeatMasker, Blast2 overlap of 20kb Breaks in alignment caused by imperfect 23mer repeat larger in AC100810 by 389bps "CCCCATCTGGTTAGAACGCTGCA", imperfect 37mer repeat larger in AC100810 by 480bps "CCCCAGGGGACAGCATGACAGATCCTCTCGCCGCACA", 5 supporting BACs 3 supporting fosmids return This probably needs additional support as to polymorphism. [email protected] AC018665 AC040980   sslp Blast2 and RepeatMasker AC018665 contains 43 bases more of AT repeat at 124167. 69000 bp total overlap pass   [email protected] AC055866 AC135721   sine Blast2 and RepeatMasker AC135721 contains 611 bp inserted region containing Alu. RP11/CIT libraries. 10000 bp total overlap, 4 supporting fosmids. pass   [email protected] AC073446 AC100756   sslp repeat masker broken overlap caused by CT_rich low complexity region (350 bp) in AC073446; join is supported by high % identity across the 162 kb overlap and 8 BAC`s and 15 fosmids which link across the join. return is 15 pairs fosmid-ends overrepresentation? Please comment. [email protected] AC000377 AC124057   line Global Sequence Alignment, RepeatMasker 49kb overlap, LINE1 insertion in AC000377, supported by 7 pairs of fosmid ends pass   [email protected] AC109341 AC131574   sine Global Sequence Alignment 55kb overlap, AluSx repeats more in AC131574, supported by 6 pairs of BAC ends, 4 pairs of fosmid ends pass   [email protected] AC055876 AC135348   sslp BLAST2, Global Sequence Alignment, RepeatMasker AC135348 contains 18 bp of (A)n that is not present in AC055876. Total overlap is 5 Kb, 14 supporting BACs, 5 supporting fosmids. AC135348 is from the RP13 library, AC055876 is from the RP11 library return is 15 pairs of BAC-ends overrepresentation? Please comment. [email protected] AC139149 AC139530   sine sequence alignment, repeat masker Insertion of ~310bp composed of 1 AluYb8 element in AC139149. Join supported by 10 BACs & 10 fosmid spanners. Total overlap 42kb. pass   [email protected] AC138080 AP000079   line Global Sequence Alignment, RepeatMasker, Blast2 overlap of 85kb, Break in alignment caused by LINE in 396bp segment in AC138080, 1 supporting BAC 3 supporting fosmids pass   [email protected] AC115090 AC124789   sslp Blast2 and RepeatMasker AC124789 contains 339 bp more of a (TA)n repeat at bp 21617 27000 bp total overlap pass   [email protected] AC091172 AC125257   other Blast2 and RepeatMasker AC091172 contains 3932 bp deletion at 164383. 126000 bp total overlap. 3 supporting Bacs; 6 supporting fosmids. return big deletion---requires additional support of polymorphism (eg pcr) [email protected] AC004908 AC131281   other Global Sequence Alignment, RepeatMasker, Blast2 overlap of 94kb Break in alignment caused by a 3934bp segment in AC131281 containing SSLP, LINEs and an analogous 520bp segment in AC004908 containing a LINE return is 15 pairs of fosmid-ends overrepresentation? Multiple variations may require additional support eg. PCR [email protected] AC104389 AC129505   other sequence alignment 778 bp deletion in AC129505, 2 pairs of fosmid end link across join return requires additional support eg. PCR [email protected] AC107971 AC130312   sslp Sequence Alignment, RepeatMasker 60kb overlap, SSLPs in centromeric region return requires BAC, fosmid end support or other [email protected] AC021317 AC115992   sslp Blast2 and RepeatMasker AC021317 contains 524 bp inserted region containing ALU at bp 36310. RP11/CIT. 21385 bp total overlap. 6 supporting bacs, 7 supporting fosmids pass   [email protected] AC100777 AC116002   sslp repeatmasker and human analysis GAA simple repeat region is ~430bp longer in AC100777; join is supported by high % identity across the overlap and 5 pairs of fosmid end seq and 8 pairs of BAC end seq which link across the join pass   [email protected] AC100791 AC116025   sslp Blast2 and RepeatMasker AC100791 contains 353 bp more of (CAT)n repeat at bp 131892 RP11/CIT. 115000bp total overlap. 6 supporting bacs, 3 supporting fosmids pass   [email protected] AC104419 AC115485   other BLAST2, RepeatMasker overlap of 27kb. Break in alignment is caused by a 3.5kb insertion (containing L2, L2, LTR60, L2) in AC115485 that is flanked by AluSx. Analogous position in AC104419 has only AluSx. RP11 clone versus GS1 clone. 3 supporting BACs, 11 supporting fosmids, 1 supporting draft, AF215849. pass   [email protected] AC105195 AP004290   line Global Sequence Alignment and RepeatMasker 44 kb overlap. Break in alignment is caused by a 317 bp L1MC/D insertion in AP004290. 2 supporting BACs, 2 supporting fosmids, and another supporting finished accession (AC104980). pass   [email protected] AP000079 AP000080 AL355484     3 supporting BACs, 1 supporting fosmid. pass   [email protected] AC091060 AC118757   sslp repeatmasker and human analysis GA-rich low complexity repeat is ~155bp longer in AC091060; join is supported by high % identity across the overlap and 5 pairs of fosmid end seq and 3 pairs of BAC end seqwhich link across the join pass   [email protected] AC104257 AC120041   other Global Sequence Alignment and RepeatMasker 68 kb overlap. Two breaks in the alignment. One is caused by 1122bp L1PA4 insertion in AC104257, while the other one is caused by a 179bp (TTATA)n insertion in AC104257. 1 supporting BAC, 4 supporting fosmids. RP11 clone versus CTD clone. pass   [email protected] AC111170 AC111182   sslp Blast2 and RepeatMasker AC111170 contains 78 bp more of unresolved homopolymeric tract at 17741-17824bp 55305 bp total overlap 5 supporting bacs, 5 supporting fosmids. pass   [email protected] AC004612 AC123779   sine Global Sequence Alignment and RepeatMasker 17 kb overlap. Break in alignment is caused by a 311 bp AluYa5 insertion in AC004612. 3 supporting BACs, 1 supporting fosmid. pass   [email protected] AC110014 AC120055   sslp repeat masker and human analysis TA simple repeat region is ~1kB longer in AC110014; join is supported by high % identity across the overlap and 1 pair of BAC end seq which link across the join pass Preferable to have additional BAC or fosmid end support [email protected] AC025018 AC117569   sslp repeatmasker and human analysis TA rich simple repeat region is ~500bp longer in AC117569; join is supported by 2 pairs of BAC end seq which link across the join pass   [email protected] AC110288 AC120035   other Global Sequence Alignment, RepeatMasker, Blast2 overlap of 29kb. Two breaks in alignment caused by imperfect 42mer repeat ("CAGCCATCCGTGGACTGGGGTAGACTGTGAGCGGTTAATC TC") that is 798bps larger in AC110288. Imperfect 45mer repeat ("CAGGTACCTGGATGGGTTCATTTGGGTGCATCACCTGGAG ACGTC") that is 225bps larger in AC110288. 1 supporting BAC, 2 supporting fosmids. pass   [email protected] AC027701 AC127034   other Global Sequence Alignment and RepeatMasker 78 kb overlap. Break in alignment is caused by a 560 bp insertion of a combination of LTR`s and a SSLPs (LTR-LTR-SSLP-LTR) in AC027701. 2 supporting BACs, 2 supporting fosmids. pass   [email protected] AC104423 AC125437   sine sequence alignment, repeat masker Insertion of ~320bp composed of 2 Alu elements in AC125437. Join supported by 4 BACs and 6 fosmids. Total overlap 45kb. pass   [email protected] AC090616 AC129917   sine Blast2 and RepeatMasker AC129917 contains 186 bp inserted region containing Alu. contains AluSq not rpesent in AC129917, 75000 bp total overlap 3 supporting Bacs; 5 supporting fosmids. pass   [email protected] AC122179 AC127030   sine repeatmasker, sequence alignment Alu, Line insertion in AC122179 return requires BAC, fosmid end support or other [email protected] AC107956 AC126389   sine RepeatMasker, Global Sequence Alignment 23kb overlap, AluSq longer in AC126389 than AC107956, supported by 2 pairs of BAC ends, 2 pairs of fosmid ends pass   [email protected] AC013791 AC131971   sine Global Sequence Alignment 19kb overlap, AluSx repeat. 2 copies in AC131971, 1 copy is AC013791, 8 fosmid ends pass is 12 pairs fosmid-ends overrepresentation? [email protected] AC108448 AC131971   sslp Global Sequence Alignment, RepeatMasker 58kb overlap, GA-rich length polymorphism: 305 bp in AC108448 (near 58042-58235), 78 bp in AC131971, supported by 4 pairs of BAC ends, 8 pairs of fosmid ends pass   [email protected] AC087386 AC126603   sslp repeat masker broken overlap caused by (CGG)n repeat (311 bp) and G-rich low complexity region (165 bp) in AC126603; join is supported by high % identity across the 27 kb overlap and 13 BAC`s and 12 fosmids which link across the join. return Are 13 BAC- and 12 fosmid-ends overrepresentation? Please comment [email protected] AC015988 AC107896   other sequence alignment Insertion of an AluYa5 repeat element in AC107896. Insertion of ~400bp of a 80bp unknown repeat element in AC107896. Join supported by 4 BACs and 14 fosmids. Total overlap 112kb. return is 21 pairs fosmid-ends overrepresentation? Also, unknown insertion requires additional support eg. PCR to support polymorphism [email protected] AC107892 AC109314   sslp repeat masker, sequence alignment CCCCAGn repeat region is ~50bp longer in AC107892; join supported by 10 BACs and 8 fosmids which link across join. Total overlap 141kb. pass   [email protected] AC026950 AC129915   other Global Sequence Alignment, RepeatMasker, Blast2 overlap of 18kb. Imperfect 54mer repeat larger by 1838bps in AC129915. 8 supporting BACs, 3 supporting fosmids. pass   [email protected] AC103725 AC131568   other Global Sequence Alignment, RepeatMasker, Blast2 overlap of 41kb. Break in alignment caused by imperfect 20mer repeat ("CAGAGGGGAACACATGGGGG") larger in AC131568 by 93bps. 4 supporting BACs, 4 supporting fosmids. pass   [email protected] AC022206 AC131390   sslp Non-experimental. Polymorphism in simple sequence repeat of GGAA in AC022206 around 164,300 bp interrupts the alignment.   pass In future, should include BAC/fosmid end support and extent of polymorphism. [email protected] AC027130 AC134300   sslp Non-experimental. Polymorphism in simple sequence repeat of TA around 5391 bp in AC007613 interrupts the alignment.   pass in future, please include BAC/fosmid end support and extent/size of variation. This also has a lot of overlap (89kb)) which would be useful to note. [email protected] AC127459 AC130450         in process   [email protected] AC010268 AC130454   sslp Non-experimental. Polymorphism in simple sequence repeat of AG around 116081 bp in AC010268 interrupts the alignment.   pass should include BAC/fosmid end support, extensive overlap (49kb), size of polymorphic region [email protected] AC009030 AC130449   sslp Non-experimental. Polymorphism in simple sequence repeats of CT around 137400 bp and GGGAT around 78000 bp in AC130449 interrupts the alignment.   pass should include BAC/fosmid end support, extensive overlap (49kb), size of polymorphic region [email protected] AC005591 AC092117         return requires additional information. Please include BAC/fosmid end or other support. Please indicate if attempts are being made to resolve. [email protected] AC092133 AC135776   sslp Non-experimental. Polymorphism in simple sequence repeat of AAAAT around 33150 bp in AC092133. OTHER EVIDENCE: Microdeletion of 538 bp at 29310 bp in AC092133 is being evaluated. in process complex, other-likely requires PCR confirmation of polymorphism [email protected] AC108134 AJ003147         in process next round, please include BAC or fosmid end support if any. [email protected] AC098805 AC106820   sslp Non-experimental. Polymorphism in simple sequence repeats around 600-700 bp of AC098805 interrupts the alignment.   return requires BAC, fosmid end support. Please include size of apparent polymorphism [email protected] AC093525 AC106820   sslp Non-experimental. Polymorphism in simple sequence repeat of AT, around 61 Kb of AC106820 interrupts the alignment.   return requires BAC, fosmid end support. Please include size of apparent polymorphism [email protected] AC025277 AC106783         in process please include BAC, fosmid end support [email protected] AC025280 AC092341   sslp Non-experimental. Polymorphism in simple sequence repeats at 6 locations interrupt the alignment. Join is supported by multiple BAC and fosmid paired ends.   pass   [email protected] AC018846 AC092126         in process   [email protected] AC018552 AC092118   sslp Non-experimental. Polymorphism in simple sequence repeat of CCAT around 10500 bp in AC018552 (around 20500 bp in AC092118) interrupts the alignment. CCAT repeat is 1.3 Kb in AC092118 vs 1.74 Kb in AC018552. Supported by multiple BAC and fosmid paired ends. pass   [email protected] AC012321 AC092115   other ? Alu deletion of 99 bp around 101645 bp in AC092115, Microdeletion of 297 bp around 111070 bp in AC092115, and deletion of 4700 bp around 3060 in AC012321 interrupt the alignment. Clones are from different BAC libraries. Join is supported by multiple BAC and fosmid paired ends. return Probably OK, but deletion should be confirmed polymorphic eg by PCR. [email protected] AC012186 AC092368         in process will resolve on next punchlist [email protected] AC007334 AC007608   sslp Non-experimental. Polymorphism in simple sequence repeat of G`s and A`s around 71428 bp in AC007334 interrupts the alignment.   pass should include size of polymorphism, BAC/fosmid end support [email protected] AC007602 AC020766   sslp Non-experimental Polymorphism in simple sequence repeats of GAAA and CT around 7250 bp in AC007602 interrupts the alignment. Supported by multiple BAC and fosmid paired ends. return Potential overrepresentation of BAC- and fosmid-ends. Investigate. [email protected] AC007613 AC007616   sslp Non-experimental. Polymorphism in simple sequence repeat of TA around 5391 bp in AC007613 interrupts the alignment.   pass OK, but in future include extent of variation and BAC/fosmid end support [email protected] AC009069 AC009094   other Non-experimental. SSLP and other. Polymorphism in simple sequence repeat of AT around 162370 bp in AC009094 interrupt the alignment. Two Alu polymorphisms, at 106374-106678 bp in AC009069 and 184078-184381 bp in AC009094. Supported by multiple BAC and fosmid paired ends. pass   [email protected] AC009088 AC093520   sslp Non-experimental. Polymorphism in simple sequence repeats at several locations interrupts the alignment.   pass should include BAC/fosmid end support, extensive overlap (49kb), size of polymorphic region [email protected] AC009090 AC023825   sslp Non-experimental. Polymorphism in simple sequence repeats of CA, and poly-A, around 192112 bp in AC009090 interrupts the alignment.   pass should include BAC/fosmid end support, length of polymorphism. [email protected] AC009155 AC026461   other Non-experimental. SSLP and other. Polymorphism in simple sequence repeat of GGAA repeats around 104053 bp in AC009155 interrupts the alignment. Polymorphism between 78050-78823 bp of AC009155 and 146099-147039 bp and microdeletion of 330 bp around 120297 of AC026461 interrupt the alignment. Supported by multiple BAC and fosmid paired ends. pass   [email protected] AC004682 AC009087         return certificate incomplete [email protected] AC006352 AC092144         in process   [email protected] AC003108 AC012621   sslp Non-experimental. Polymorphism in simple sequence repeat of TA around 53200 bp in AC012621 interrupts the alignment.   pass Should include BAC, fosmid end support in future [email protected] AC002331 AC008756   sslp Non-experimental. Polymorphism in simple sequence repeats at several location interrupts the alignment. Finishing quality will be evaluated.   in process please include size of polymorphism, BAC/fosmid end support [email protected] AC007842 AC011536   other no experimental Clones overlapping in a tandem repeat. Join supported by AC139454 and also 7 other fosmid end pairs pass   [email protected] AC008568 AC010482   other no experimental 123bp indel in AC010482. Join supported by one pair of BAC ends and 2 pairs of fosmid ends. return This in/del require s other support, eg PCR. [email protected] AC008659 AC093290   other No experimental Number of repeats varies between clones. AC008659 is tagged in the GenBank entry as unsure # of repeat copies. Join is supported by 11 pairs of fosmid ends. return Is 11 pairs of fosmid-ends overrepresentation? Also, requires additional support eg. PCR [email protected] AC008892 AC016596   sslp no experimental 543bp indel in TA region. Join supported by 1 pair of BAC ends and 1 pair of fosmid ends pass   [email protected] AC008939 AC020930       AC008939 clipped too short. Being refinished to extend the overlap. in process   [email protected] AC010442 AC106772   other no experimental Variation between Caltech D and RP11 clones in telomeric region. Join supported by the draft clone AC138432. Also one other pair of BAC ends and 7 pairs of fosmid ends pass   [email protected] AC010470 AC022450   sslp no experimental 153bp simple sequence polymorphism at the end of the clone. Join supported by 3 pairs of BAC ends. pass   [email protected] AC011407 AC090064   sslp no experimental 185bp indel in TA region. Join supported by 2 pairs of BAC ends. pass   [email protected] AC027310 AC027316   other no experimental VNTR 29mer attcttatatatattctaagaaatatac repeated twice in AC027310 and 13 times in AC027316. Join supported by 2 pairs of BAC ends. pass   [email protected] AC093528 AC094099       AC093528 clipped too short. Being refinished to extend the overlap. in process   [email protected] AC114288 AC114307   sslp no experimental 214bp indel in TA region. Join supported by 5 pairs of BAC ends. return Greg`s site lists no supporting BAC or fosmid-ends. requires BAC, fosmid end support or other [email protected] AC022093 AC122716       Repeat on the end of the clones. Another clone in progress to reinforce the join. in process   [email protected] AC010600 AC020936   sslp no experimental 147bp indel in TA region. Join supported by 8 pairs of BAC ends. pass   [email protected] AL160006 AL355990       overlap between position 89784-91783 in AL160006 and 1-2000 in AL355990 return Unsure re. the nature of the problem. What type of cert. is this? If previously a blunt/short join, then this is OK, please update certificate or accession to remove. If this is a polymorphic join, please resubmit with type and length of polymorphism. [email protected], [email protected] AL139141 AL390718   other Sequence alignment and manual checking 21000bp overlap between position 155124-176094 in AL390718 and 1-20691 in AL139141. 13bp interruption to alignment at ~164637 in AL390718. Join Supported by 6 pairs BAC ends and 9 pairs Fosmid ends. pass Long overlap, small variation. [email protected] AL035411 AL365187   sslp Sequence alignment and manual checking 2263bp oveplap. Variation in overlap and CA repeat at ~1530bp and ~1800bp in AL035411 interupting alignment. Join supported by 3 pairs BAC ends and 7 pairs Fosmid ends. pass   [email protected] AC099563 AC114496   other Sequence alignment and manual checking 93835bp overlap between 93296-186551 in AC114496 and 1-93835 in AC099563. 230bp difference in TA repeat at ~118664bp in AC114496 interrupting alignment. Join Supported by 7 pairs BAC ends and 4 pairs Fosmid ends pass Long overlap, small variation. [email protected] AC099570 AC099571   other Sequence alignment and manual checking 86042bp overlap between position 81372-157413 in AC099571 and 1-85817 in AC099570. Disruption in alignment at 87144bp in AC099571. Join Supported by 8 pairs BAC ends and 11 pairs Fosmid ends pass Probably OK because of long overlap, and small number of differences. [email protected] AC093575 AC095030   other Sequence alignment and manual checking 44080bp overlap between position 1-43867 in AC095030 and 115151-159238 in AC093575. TA rich tandem repeat showing variation and several in/dels between the two accessions. TA repeat 220bp longer in AC093575 at ~134387bp. Join Supported by 2 pairs BAC ends and 2 pairs Fosmids ends return probably OK because of long overlap, but multiple `other` variations need additional support of polymorphism (eg, pcr) [email protected] AC092801 AC094022   other Sequence alignment and manual checking 71918bp overlap between position 79465-151198 in AC092801 and 1-71918 in AC094022. Join supported by 4 pairs BAC ends and 8 pairs Fosmid ends pass Probably OK because of long overlap, and small number of differences. [email protected] AC009988 AC026395       overlap between position 119060-174398 in AC009988 and 1-55109 in AC026395 pass Large overlap, even though lack of end-to-end align. [email protected] AL157705 AL392103       Join supported by 4 pair(s) of human BAC ends, CTD-2258H15,RP11-148C9,RP11-794O16,RP11-982I3. PCR on genomic sample in process to confirm the overlap. in process previously returned [email protected] AL365356 BX276080         in process should drop from list next round [email protected] AC012469 AL772287 AC016826     Overlap of 6bp at GAATTC cloning site. Join supported by genomic sequence AC016826 RP11-570J13. Join supported by 1 pair(s) of human BAC ends and 7 pair(s) of human fosmid ends. pass   [email protected] AC121340 AC140846   other resubmisson of AC002357 in process 682 bp N`s are in AC002357.1. in process   [email protected] AL590763 BX276092       New this time. In process. Problem caused by error in assembly of AL590763 (MPIMG to correct). Can be avoided temporarily by use of switchpoint in AGP. in process   [email protected] AC074034 AC108685 AC106713       pass   [email protected] AL133277 Z70689       E-certificate previously submitted (NCBI joins). pass   [email protected] AL109801 Z68331       Resubmission to produce a 2000 bp overlap is in progress. in process   [email protected] AL035609 AL590069       We have exchanged emails about this one earlier. 2000 base overlap. pass   [email protected] AL022155 Z70281       Resubmission to produce a 2000 bp overlap is in progress. in process   [email protected] AJ271735 AJ271736 none     Originally submitted in one piece as Y19189. Split into two segments by EMBL according to the authors (IIGB). Inclusion of Y19189 will cause problems as it is the secondary accession of each. disputed This is an old compound accession on chrX. Almost certainly OK, but technically not according to standard. It is supported by fosmid and BAC end links. [email protected] AL008706 AL133546       New this time. 100 base overlap. pass   [email protected] AC109993 AL645722       In process. Both sequences have been recently resubmitted by the respective centres (IMB, IIGB). The problem is caused by a small piece of sequence (~4 kb) that is rotated between the two accessions. One must be incorrect as both clones are from the same X chromosome. Evaluation and correction will be carried out by the two centres. Submitted also as E-certificate to NCBI joins. in process   [email protected] AF277315 L44140   other IMB resequenced 676 bp of G6PD intron 2 containing six of the divergent positions in 6 women and 11 men of Caucasian origin. In all checked chromosomes the sequences were identical to AF277315, indicating that L44140 variants represent rare alleles in th resubmission of L44140 clipped back to 2000 bp overlap with AF277315 would resolve the failure to detect overlap computationally. Join supported by 1 pair BAC ends, 6 pairs fosmid ends. unresolved In the strictest sense, this could be seen as unresolved, since the polymorphism was not seen in the panel, but the efforts are as far as anyone could reasonably ask. Please do not resolve by clipping this back. It is preferable to have some mechanism where a user looking at this region could retrieve the certificate to see what additional measures had been taken to confirm. No further action is necessary. [email protected] AC003659 AC121344   line PCR on genomic samples in process to confirm ~400bp LINE element present in AC121344.5 breaks alignment; join is supported high % identity across the overlap in process if BAC or fosmid end support is available, PCR is not required [email protected] AC108359 AC117405   sslp PCR on genomic samples in process to confirm dinucleotide repeat region is ~75bp longer in AC108359; join is supported by 5 pairs of BAC ends pass with BAC end support, no further action is required [email protected] AC006062 AC073533   sslp PCR on genomic sample in process to confirm the polymorphism AG repeat region 350 bp longer in AC006062.4; Join supported by 1 pair of human BAC end. pass with BAC end support, no further action is required [email protected] AC091810 AL592164       AC091810.2 contains 30 bp of vector sequence. Clipping and resubmission will solve this problem in process   [email protected] AC108359 AC112496   sslp PCR on genomic samples in process to confirm trinucleotide repeat region is ~765bp longer in AC112496; join is supported by high % identity across the overlap and 5 pairs of BAC ends pass with BAC end support, no further action is required [email protected] AL591379 AL845321   none   Pericentromeric segmental duplicated region in process previously E-CERTIFICATE IN PROCESS. TPF revised in this region. Should wait to resolve through next round of punchlists. alignment does not extend to end of AL845321 [email protected] AL359955 AL445665   none   Pericentromeric segmental duplicated region in process previously E-CERTIFICATE IN PROCESS. TPF revised in this region. Should wait to resolve through next round of punchlists. alignment does not extend to end of AL445665 [email protected] AL445595 AL512635       Additional 73bp of sequence in AL445595; GAGCTCGGTACCCGGGGATCTAGAGTACTGGTTGAAACCCGG ATCATGCATCAGTACGCGTGAGCTCGAATTC represents contamination; matches cloning vector - pBACe3.6. Resolve by re-submitting AL445595. in process   [email protected] AL163528 AL442637       AL163528 is currently not finished, which is sending the algnment off. Resolve by finishing AL163528 in process   [email protected] AL163528 AL357614   none   Presence of Ns in finished clone AL357615. Version .7 has been corrected. Join supported by 4 pair(s) of human BAC ends. Join supported by 3 pair(s) of human fosmid ends in process Should be resolved in next round [email protected] AL355151 AL627230   none   Pericentromeric segmental duplicated region in process   [email protected] AL592525 AL954685   none   Pericentromeric segmental duplicated region disputed previously returned. This will not be resolved soon. [email protected] AL591438 AL627230   none   Pericentromeric segmental duplicated region in process previously E-CERTIFICATE IN PROCESS. TPF revised in this region. Should wait to resolve through next round of punchlists. no alignment found [email protected] AL590711 BX001034   none   Pericentromeric segmental duplicated region in process previously E-CERTIFICATE IN PROCESS. TPF revised in this region. Should wait to resolve through next round of punchlists. no alignment found [email protected] AL445643 BX001034   none   Pericentromeric segmental duplicated region in process previously E-CERTIFICATE IN PROCESS. TPF revised in this region. Should wait to resolve through next round of punchlists. AL445643 is contained in BX001034 [email protected] AL359955 AL512605   none   Pericentromeric segmental duplicated region in process previously E-CERTIFICATE IN PROCESS. TPF revised in this region. Should wait to resolve through next round of punchlists. internal alignment (no dovetail) [email protected] AL591424 AL954642   other In progress GC rich tandem 9qtleomeric region. Indel in tandem, 22kb match then 305bp missing from AL954642.9 (RP11-885N19) from 21904. 302bp extra in tandem in AL591424.11 (RP11-424E7) from 135208-135513. Then 66kb match. Also Riethman half YAC in pipeline. in process   [email protected] AL162415 BX248098   none   Pericentromeric segmental duplicated region supported by 11 pair(s) of human BAC ends in process   [email protected] AL162731 AL591926   none   Pericentromeric segmental duplicated region. Join supported by 6 pair(s) of human BAC ends. Join supported by 15 pair(s) of human fosmid ends in process   [email protected] BX005195 BX248112   none   Pericentromeric segmental duplicated region in process   [email protected] AL354874 AL391987   none   Pericentromeric segmental duplicated region in process   [email protected] AL357615 AL391117   none   Presence of Ns in finished clone AL357615. Version .7 has been corrected. Join supported by 9 pair(s) of human BAC ends. Join supported by 1 pair(s) of human fosmid ends in process Should be resolved in next round [email protected] AL158832 AL356244   other To be tested Alu. 9ptelomeric region. Indels in Alu repeats disrupting join. Join supported by 2 pair(s) of human BAC ends. Join supported by 10 pair(s) of human fosmid ends in process   [email protected] AC105266 AC134025   sslp cross_match, inspection in Consed Alignment broken by deletions in imperfect `ggaaa` pentanucleotide repeats. Join supported by 6 pairs of BAC ends and 5 pairs of fosmid ends pass   [email protected] AC013421 AC140060   none none GenBank record for AC140060 is incorrect. The previous version is correct (gi:28460722) and will be updated in process   [email protected] AC105765 AC139618   other None Gap between this pair is now filled with RP11- 158G18 (Type1) on tpf. return On Greg`s site says "sequence_not_yet_analyzed"; May require BAC, fosmid end support or other. Or, may resolve with next compute. [email protected] AC134998 AC136189   sslp PCR on genomic samples in progress to confirm tandem repeat region is ~150bp longer in AC134998 in process   [email protected] AC104448 AC134772   other cross_match, inspection in Consed SINE/SSLP Three breaks in alignment: First break due to ALU repeats, second due to dinucleotide repeat polymorphism and third break due to ALU repeats copy number. Join supported by 7 pairs of fosmid ends. pass   [email protected] AC107304 AC108697   other sequence transposon sequence in AC107304 not excised; resubmission in progress in process   [email protected] AC025572 AC116991   line cross_match, RepeatMasker Alignment broken by a 6Kb LINE insertion in AC116991.2. Join supported by 5 pairs of BAC and 12 pairs of fosmid ends pass is 12 pairs fosmid-ends overrepresentation? [email protected] AC063927 AC117435   other PCR on genomic samples in progress to confirm ~255bp insertion in AC063927 breaks alignment Polymorphism; 299 bp AluY insertion in AC112646.9; in process requires BAC, fosmid end support or other [email protected] AC078788 AC117421   sine   120bp AluY insertion in AC117421.6; Join supported by 2 pairs of human BAC ends pass   [email protected] AC087879 AC090052   sslp   GT simple repeat longer in AC087879; join is supported by 2 pairs of BAC ends pass   [email protected] AC007934 AC128680   other PCR on genomic sample in progress to confirm polymorphism LINE and OTHER. 70 bp insertion and 520 bp L1MB6 insertion in AC128680.6; Join supported by 2 pairs of human BAC ends. return `other` requires additional support, eg PCR [email protected] AC099047 AC131013   line PCR on genomic samples in progress to confirm ~8kb LINE element present in AC131013 breaks Alignment pass pcr confirm not required [email protected] AC112646 AC130888   sine confirmed by genomic PCR polymorphism 299 bp AluY insertion in AC112646.9; pass   [email protected] AC104190 AC124916   sine cross_match, inspection in Consed Alignment broken by 131 bases of ALU sequences in AC124916.3. Join supported by 2 pairs of BAC and 3 pairs of fosmid ends. pass   [email protected] AC108486 AC109585   other none Problem with AC109585 - currently being resubmitted. pass Already resolved in TPF [email protected] AC099780 AF152364   other none Two breaks in the alignment: The first is due to sequence length polymorphisms at 87223 (AC099780 coordinates) and the other is due to dinucleotide repeats polymorphism at 95133. Otherwise join looks OK. Join supported by 7 pairs of BAC and 10 pairs of fosmid ends. PCR validation pending. in process OK, but encourage pcr validation [email protected] AC103587 AC114398   other none 310-base internally duplicated region in AC114398 between 225316 and 225625. Another copy between 223978 and 224287. Join supported by 4 pairs of BAC and 3 pairs of fosmid ends. PCR validation pending. in process   [email protected] AC096917 AF152363   other cross_match, inspection in Consed AF152363 not finished to current standards. Looks OK. in process already removed from punchlist [email protected] AC026305 AC068757   sslp PCR on genomic samples in progress to confirm tandem repeat region is ~225bp longer in AC026305 pass pcr not required [email protected] AC089985 AC090051   sine   AluYb8 element present in AC090051 breaks alignment; join supported by 6 pairs of BAC ends pass   [email protected] AC034187 AC068312   other Global Sequence Alignment, RepeatMasker, Blast2 overlap of 41kb. Break in alignment caused by imperfect 80mer repeat that is 876bps larger in AC034187. 4 supporting BACs, 5 supporting fosmids. pass   [email protected] AC046134 AC110716   sslp join is supported by 7 pairs of human BAC ends GT simple repeat region 10 bp longer in AC110716.5 pass   [email protected] AC069261 AC073916   none none AC069261 is being resubmitted (see gi:22094222) in process will disappear [email protected] AC018842 AC066608   other Global Sequence Alignment, RepeatMasker, Blast2 overlap of 52kb. Break in alignment caused by a simple repeat (TA)n larger in AC066608 by 686bps. 2 supporting BACs, 6 supporting fosmids. pass   [email protected] AC021999 AC090955   other Global Sequence Alignment, RepeatMasker, Blast2 overlap of 98kb. Break in alignment caused by two simple repeats (CA)n and (TA)n larger in AC021999 by 152bps. 3 supporting BACs, 9 supporting fosmids. pass   [email protected] AC023481 AC087859   other Global Sequence Alignment, RepeatMasker, Blast2 overlap of 55kb. Break in alignment caused by SVA repeats larger in AC087859.3 by 508bps. 1 supporting BACs, 5 supporting fosmids. pass   [email protected] AC024163 AC026194   sine Global Sequence Alignment, RepeatMasker, Blast2 overlap of 88kb. Two breaks in alignment caused by two 322bp SINE insertion in AC024163. 5 supporting BACs, 5 supportings fosmids. pass   [email protected] AC006205 AC021054   sslp correct sequence alignment AC006205 was resubmitted, eliminating problem in process   [email protected] AC004216 AC007425   sslp   repeat region ~500bp longer in AC007425; join is supported by 3 pairs of BAC ends pass   [email protected] AC004801 AC074029   sslp   TA repeat region ~200bp longer in AC074029; join supported by 4 pairs of BAC ends pass   [email protected] AC010370 AC026118   sslp Join supported by 4 pairs of human BAC ends tandem repeat 200 bp longer in AC026118.17 pass   [email protected] AC009811 AC055712   other   157 bp insertion in AC055712.13; Join supported by 4 pairs of human BAC ends return `other` requires additional support eg pcr. [email protected] AC006512 U47924   other sequence alignment n`s in submission; resubmission in progress in process   [email protected] AC011609 AC087428   sine Global Sequence Alignment, RepeatMasker, Blast2 overlap of 60kb. Break in alignment caused by a SINE repeat larger in AC011609 by 267bps. 4 supporting BACs, 4 supporting fosmids. pass   [email protected] AC010200 AC010209   other sequence alignment n`s in submission; resubmission in progress in process   [email protected]] AC073244 AC092969         in process   [email protected]] AC093927 AC098971   none   AC093927 contains vector sequence on the ends; UWGC is filtering and resubmitting; join is supported by 6 pair of BAC-ends in process   [email protected]] AC092947 AC130416         in process   [email protected]] AC091212 AC108678         in process   [email protected]] AC079602 Z98941   none ? clone pair is currently being analyzed; join is supported by 2 pair of BAC-ends in process may need pcr analysis if variation is not simple [email protected]] AC087447 AC103854 AC090163     6 bp overlap supported by finished GenBank sequence AC090163.10 (RP11-706A13) pass   [email protected] AC023080 AC134982 AC126324     6 bp overlap supported by finished GenBank sequence AC126324.3 (RP11-358H20) pass   [email protected] AP000807 AP002813 AP002366     6 bp overlap supported by finished GenBank sequence AP002366.4 (RP11-142N13) pass   [email protected] AP001189 AP003119 AP003101     6 bp overlap supported by finished GenBank sequence AP003101.2 (RP11-30J7) pass   [email protected] AP003120 AP006215 AC026168     6 bp overlap supported by finished GenBank sequence AC026168.3 (RP11-156E23) pass   [email protected] AP001790 AP001876 AP000652     6 bp overlap supported by finished GenBank sequence AP000652.4 (CMB9-8G5) pass   [email protected] AP000848 AP003781 AP000929     6 bp overlap supported by finished GenBank sequence AP000929.5 (RP11-778B17) pass   [email protected] AP002453 AP003387 AP003384     6 bp overlap supported by finished GenBank sequence AP003384.2 (RP11-35N19) pass   [email protected] AP005435 AP005814   other Blast2, RepeatMasker SINE/LINE/SSLP. Overlap of 28 kb. Break in alignment caused by deletion of six neighboring SINE/LINE/DNA elements and a (CTTTG)n region for a total of 6014 bp found in AP005435 but not present in AP005814. Join supported by 3 pairs of human BAC ends. pass multiple, but fairly straightforward [email protected] AP001166 AP005202   other Blast2, Tandem Repeats Finder, RepeatMasker Overlap of 37 kb. Break in alignment caused by near-perfect 14-mer repeat (CATGGCCCTATATG) that is 364 bp longer in AP001166. There are 34.1 copies in AP001166 and 8.1 copies in AP005202. Join supported by 2 pairs of human BAC ends and 5 pairs of human fosmid ends. pass   [email protected] AP001028 AP001029   line Blast2, RepeatMasker Overlap of 118 kb. Break in alignment caused by deletion of a 6228 bp LINE/L1HS element found in AP001028 but not present in AP001029. Join supported by 1 pair of human BAC ends and 11 pairs of human fosmid ends. pass is 11 pairs fosmid-ends overrepresentation? [email protected] AP003783 AP005401   other Blast2, RepeatMasker LTR/SSLP. Overlap of 6.3 kb. Break in alignment caused by deletion of LTR/ERVL element and a (TA)n region for a total of 235 bp found at the end AP003783 but not present in AP005401. Join supported by 2 pairs of human BAC ends and 1 pair of human fosmid ends. The sequence will be confirmed. pass encourage additional confirmation in process [email protected] AP005232 AP005379   other Blast2, Tandem Repeats Finder Overlap of 24 kb. Break in alignment caused by imperfect 15-mer repeat (ATCATCATCATCACC) that is 198 bp longer in AP005379. There are 39.7 copies in AP005379 and 16.6 copies in AP005232. No supporting BACs/fosmids, but otherwise high % identity. return requires BAC, fosmid end support or other [email protected] AP003037 AP003108   other Blast2, RepeatMasker SINE/LINE. Overlap of 14 kb. Break in alignment caused by deletion of two neighboring SINE/LINE elements for a total of 338 bp found in AP003108 but not present in AP003037. Join supported by 4 pairs of human BAC ends and 5 pairs of human fosmid ends. Also confirmed by PCR. pass   [email protected] AP003395 AP003396   other Blast2, RepeatMasker Overlap of 71 kb. Break in alignment caused by deletion of 216 bp in an SVA element in AP003396. Join supported by 2 pairs of human BAC ends and 10 pairs of human fosmid ends. pass   [email protected] AP003500 AP003782   other Blast2, Tandem Repeats Finder Overlap of 60 kb. Break in alignment caused by imperfect 34-mer repeat (ATATATTCTACAGAATACGTATATTCTATTCTAC) that is 314 bp longer in AP003500. There are 21.3 copies in AP003782 and 30.3 copies in AP003500. Join supported by 2 pairs of human BAC ends and 7 pairs of human fosmid ends. pass VNTR [email protected] AP003780 U73634       Overlap of 15 kb. U73634 is an old cosmid clone of questionable quality finished at University of Texas Southwestern Medical Center. The last 164 bases of U73634 do not match the corresponding region of AP003780. We are going to replace U73634 with another clone, RP11-466C23. in process   [email protected] AP000311 AP000312 none     Short overlap is an artifact of the nested deletion method. Briefly, a library of nested deletion clones was constructed, a map was then made by using the end sequences from multiple restriction fragments, the overlaps for each clone were confirmed by sequencing, and finally a minimal set of clones was chosen for finishing. Join supported by 1 pair of human fosmid ends. disputed Likely to be OK. However, sequencing by nested deletions was not discussed in view of the certificates. Computational verification will not be possible without a spanning clone under current criteria. [email protected] AP000336 AP000337 none     Short overlap is an artifact of the nested deletion method. Briefly, a library of nested deletion clones was constructed, a map was then made by using the end sequences from multiple restriction fragments, the overlaps for each clone were confirmed by sequencing, and finally a minimal set of clones was chosen for finishing. Join supported by 1 pair of human BAC ends and 2 pairs of human fosmid ends. disputed Likely to be OK. However, sequencing by nested deletions was not discussed in view of the certificates. Computational verification will not be possible without a spanning clone under current criteria. [email protected] AP000438 AP001160   other Blast2, RepeatMasker SINE/LINE. Overlap of 74 kb. Break in alignment caused by deletion of two neighboring SINE/LINE elements for a total of 460 bp found in AP001160 but not present in AP000438. Join supported by 5 pairs of human BAC ends and 2 pairs of human fosmid ends. pass   [email protected] AP000689 AP000690   sine Blast2, RepeatMasker Overlap of 7.6 kb. Break in alignment caused by deletion of a 299 bp SINE/AluSg element found in AP000690 but not present in AP000689. Join supported by 1 pair of human fosmid ends. pass   [email protected] AP000702 AP000703       Break in alignment caused by a ~26 kb deletion in AP000702 between bases 38400 and 38401 which is covered by AP000703 and AP000704; the next few hundred bases after the deletion point are chimeric, so the last 2475 bp are not used in the AGP. Join supported by 1 pair of human fosmid ends. return requires additional support eg. Pcr. [email protected] AP000708 AP003069   other Blast2, Tandem Repeats Finder Overlap of 63 kb. Break in alignment caused by near perfect 125-mer repeat (CAGCACGGCCACTAGCTCTGCTCAAGAAACAAGTCTGCGTC TCCTTATTGTGCTAGTTCATTCCTCAGTTCACTACACAATCCT TCAACGTTGGCCTCTTTGCCTGTCTGCACACTGTGCCTGGT) that is 107 bp longer in AP000708. There is 1 copy in AP003069 and 2 copies in AP000708. Join supported by 2 pairs of human BAC ends and 11 pairs of human fosmid ends. pass VNTR; Is 11 pairs fosmid-ends overrepresentation? [email protected] AP000729 AP001885   sslp Blast2, Tandem Repeats Finder, RepeatMasker Overlap of 6.5 kb. Break in alignment caused by simple repeat (TG)n that is 12 bp longer in AP001885. There are 17 copies in AP000729 and 23 copies in AP001885. Join supported by 2 pairs of human BAC ends and 2 pairs of human fosmid ends. pass   [email protected] AP000924 AP001883       Join supported by 2 pairs of human BAC ends and 2 pairs of human fosmid ends. Overlap of 60 kb. The last 43 bp of AP000924 do not match the corresponding position within AP001883, the sequence will be confirmed. There is high % identity otherwise. in process   [email protected] AP000926 AP003040   sine Blast2, RepeatMasker Overlap of 4 kb. Break in alignment caused by deletion of three neighboring SINE elements and an AT_rich region for a total of 1146 bp found in AP000926 but not present in AP003040. Join supported by 3 pairs of human BAC ends and 1 pair of human fosmid ends. pass   [email protected] AP001050 AP001051   other Blast2, Tandem Repeats Finder Overlap of 27 kb. Break in alignment caused by imperfect 20-mer repeat (TGCTGAGGGAGATGAGGGCC) that is 504 bp longer in AP001051. There are 95.9 copies in AP001050 and 120.9 copies in AP001051. Join supported by 3 pairs of human fosmid ends. pass   [email protected] AP001064 AP001065   other Blast2, Tandem Repeats Finder Overlap of 25 kb. Break in alignment caused by imperfect 41-mer repeat (CACTGTCTTGGTTGGCGTAGCCTTGTAGTAAGTTTTGACCG) that is 727 bp longer in AP001065. There are 25.9 copies in AP001064 and 40.9 copies in AP001065. Join supported by 1 pair of human fosmid ends. pass   [email protected] AP001620 AP001621   other Blast2, Tandem Repeats Finder Overlap of 20 kb. Break in alignment caused by imperfect 50-mer repeat (CAACACCTCCATCACCAACAGAAACCAGGCGGGGCCAGCTGA CCCCAGAG) that is 235 bp longer in AP001620. There are 13.1 copies in AP001620 and 8.1 copies in AP001621. Join supported by 1 pair of human BAC ends and 5 pairs of human fosmid ends. pass   [email protected] AP001625 AP001626   other Blast2, Tandem Repeats Finder Overlap of 39 kb. Break in alignment caused by imperfect 51-mer repeat (AGCCTCCCGCCCCGTTTACATCCACGCAGGCGTTTCCCCTT ACCTGCACCG) that is 2023 bp longer in AP001625. There are 58 copies in AP001625 and 16.4 copies in AP001626. Join supported by 1 pair of human BAC ends and 10 pairs of human fosmid ends. pass   [email protected] AP001874 AP003170   sine Blast2, RepeatMasker Overlap of 55 kb. Break in alignment caused by deletion of 1485 bp of SINE/Alu elements found in AP001874 but not present in AP003170. Join supported by 4 pairs of human BAC ends and 3 pairs of human fosmid ends. pass   [email protected] AP001883 AP001980   other Blast2, Tandem Repeats Finder Overlap of 31 kb. Break in alignment caused by imperfect 17-mer repeat (AGAGTATATGCAGTGAT) that is 223 bp longer in AP001980. There are 65.2 copies in AP001883 and 79.2 copies in AP001980. Join supported by 2 pairs of human BAC ends and 1 pair of human fosmid ends. In addition, the first 10 bp of AP001980 do not match the corresponding position within AP001883, the sequence will be confirmed. pass   [email protected] AP001925 AP002433   other Blast2, RepeatMasker SINE/LINE/SSLP. Overlap of 16 kb. Break in alignment caused by deletion of six neighboring SINE/LINE elements and a (TA)n region for a total of 1382 bp found in AP002433 but not present in AP001925. Join supported by 7 pairs of human BAC ends and 5 pairs of human fosmid ends. pass multiple, but fairly straightforward [email protected] AP001994 AP003390   sine Blast2, RepeatMasker Overlap of 97 kb. Break in alignment caused by deletion of a 264 bp SINE/AluYa5a2 element found in AP001994 but not present in AP003390. Join supported by 6 pairs of human BAC ends and 19 pairs of human fosmid ends. return Probably OK, but is 19 pairs fosmid-ends overrepresentation? Please comment. [email protected] AL109761 AP000432   sslp Blast2, Tandem Repeats Finder, RepeatMasker Break in alignment caused by simple repeat (T)n that is 22 bp longer in AP000432. There are 42 copies in AP000432 and 20 copies in AL109761. Join supported by excellent sequence alignment. Join supported by 2 pairs of human BAC ends and 1 pair of human fosmid ends. pass   [email protected] AF020802 AP000687   other Blast2, RepeatMasker Overlap of 52 kb. Break in alignment caused by partial deletion of a SVA element which is 231 bp longer in AP000687 than in AF020802. Join supported by 4 pairs of human fosmid ends. pass   [email protected] AF045449 AF064857   other Blast2, Tandem Repeats Finder Overlap of 12 kb. Break in alignment caused by two neighboring imperfect repeats, the first is a 59-mer (TGTTGGCCTCCTTTTCCTATTGCCTTCTCCTCAATGCCTGTG TCTGAAATTGCCATAGG) and the second is a 74-mer (ATAGGTGTTGGCCTCCTTTTCCTATTGCCTTCTCCTCTATGCC TGTGTCTGAAATTGCCCTCCACCCTTCTCTT) which results in AF045449 being 198 bp longer. There are 1.9 copies of the 51-mer and 7.1 copies of the 74-mer in AF064857. There are 3.9 copies of the 51-mer and 8.1 copies of the 74-mer in AF045449. Join supported by 2 pairs of human fosmid ends. pass   [email protected] AF135405 AP001138       There is an 85 kb deletion in AF135405 which is covered by AP001138. return requires additional confirmation that deletion is a polymorphism eg by pcr. [email protected] AF227510 AF260011   other Blast2, RepeatMasker SINE/LINE. Overlap of 30 kb. Break in alignment caused by deletion of a 311 bp SINE/AluY element and a 217 bp LINE/L1MC1 element both found in AF227510 but not present in AF260011. Join supported by 2 pairs of human BAC ends and 2 pairs of human fosmid ends. pass multiple, but straightforward [email protected] AF240627 AL109763   other Blast2, RepeatMasker, Tandem Repeats Finder LINE/other. Overlap of 105 kb. Break in alignment caused by two differences. The first is a variation in a LINE/L1 element which is about 300 bp shorter in AF240627. The second is caused by an imperfect 50-mer repeat (GGCACGCCATTCCCTGTTACCTGCATCAGTGACTGATCAGA ATGGGGTAA) that is 250 bp longer in AF240627. There are 8.9 copies in AL109763 and 14.9 copies in AF240627. Join supported by 1 pair of human BAC ends and 7 pairs of human fosmid ends. pass VNTR [email protected] AC027239 AP001998   other Blast2, RepeatMasker LINE/SSLP. Overlap of 68 kb. Break in alignment caused by deletion of two neighboring LINE/L1HS elements and a (A)n region for a total of 1637 bp found in AC027239 but not present in AP001998. Join supported by 10 pairs of human BAC ends. Another clone, RP11-24F19, is being sequenced to confirm this overlap. in process   [email protected] AC073071 AC073387 AC073103     Minimal overlap was finished, but AC073103 confirms overlap. Overlap also supported by BAC end pairs. pass   [email protected] AC073081 AC109822   sine polymorphic based on genomic pcr assay Alu. AC073081.5 contains 312bp more data than AC109822.5, indel present, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join is also supported by bac and fosmid end pairs pass   [email protected] AC073094 AC091729   other polymorphic based on genomic pcr assay indel present, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join also supported by fosmid and bac end pairs pass   [email protected] AC073216 AC093655   other polymorphic based on genomic pcr assay AC093655.4 contains 150 bp more than AC073216.7, bp differences in the overlap were assayed and the overlap was found to be polymorphic pass   [email protected] AC073236 AF109076   other polymorphic based on genomic pcr assay AC073236.8 contains 231bp more than AF109076.1, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join is also supported by bac and fosmid end pairs pass   [email protected] AC068196 AC104076   sine repeatmasker Alu. 68409 bp overlap, AC104076.5 contains 313bp more data than AC068196.4, AC068196.4 contains 295bp more data than AC104076.5, join is also supported by bac and fosmid end pairs pass   [email protected] AC058823 AC108159   other repeatmasker LTR/MaLR, LINE/L2, SINE/MIR, DNA/MER2_type. 44728 bp overlap, AC058823.4 contains 2196bp more data than AC108159.5, join supported by bac and fosmid end pairs pass   [email protected] AC066692 AC079924   other polymorphic based on genomic pcr assay SINE/Alu, LINE/L1. AC066692.3 contains 541bp more data than AC079924.6, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join is also supported by bac and fosmid end pairs pass   [email protected] AC073249 AF104455 AC073249     no overlap was finished, but sequence from a previous accession version confirms overlap pass   [email protected] AC073336 AC093726 AC073077     Minimal overlap was finished, but AC073077 confirms overlap. Overlap also supported by BAC and fosmid end pairs. pass   [email protected] AC073344 AC093592   sine polymorphic based on genomic pcr assay Alu. AC073344.7 contains 298bp and 307bp more data than AC093592.3, multiple indels also present, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join supported by bac and fosmid end pairs pass   [email protected] AC073879 AC108929   sine polymorphic based on genomic pcr assay Alu. AC073879.7 contains 4bp more data than AC108929.4, AC108929.4 contains 1982bp more data than AC073879.7, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join is also supported by bac and fosmid end pairs pass   [email protected] AC074257 AC093583   other polymorphic based on genomic pcr assay AC074257.5 contains 1165bp more than AC093583.3, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join is also supported by bac and fosmid end pairs pass 11 fosmid-ends - is this overrepresentation? [email protected] AC068537 AC110807   line polymorphic based on genomic pcr assay L2. AC110807.3 contains 218bp more data than AC068537.5, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join is also supported by bac and fosmid end pairs pass   [email protected] AC025561 AC093764   other polymorphic based on genomic pcr assay 2084 bp overlap, indel present, join supported by bac and fosmid end pairs, bp differences in the overlap were assayed and the overlap was found to be polymorphic pass   [email protected] AC025821 AC093803   other polymorphic based on genomic pcr assay SINE/Alu, LTR/ERV1, LINE/L2, LINE/L1. AC093803.3 contains 8489bp more data than AC025821.7, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join supported by bac and fosmid end pairs pass   [email protected] AC020601 AC093674 AC019304     another accession sequenced to confirm join pass   [email protected] AC021127 AC105917 AC025602     another accession sequenced to confirm join pass   [email protected] AC107464 AC139887   line repeatmasker L1. 4p telomere, 91687 bp overlap, AC139887.1 contains 1003bp more than AC107464.5, AC107464.5 contains 133bp more than AC139887.1, multiple indels present, supported by bac and fosmid end pairs pass   [email protected] AC093877 AC131947   sine polymorphic based on genomic pcr assay Alu. multiple indels present, join supported by bac and fosmid endpairs, bp differences in the overlap were assayed and the overlap was found to be polymorphic pass   [email protected] AC019195 AL133244 AC019195     no overlap was finished, but sequence from a previous accession version confirms overlap pass   [email protected] AC093886 AC131945   other polymorphic based on genomic pcr assay SINE/Alu, LINE/L1. AC131945.1 contains 226bp more data than AC093886.2, AC093886.2 contains 6062bp more data than AC131945.1, join supported by bac and fosmid end pairs, bp differences in the overlap were assayed and the overlap was found to be polymorphic pass   [email protected] AC017084 AC022201   other repeatmasker DNA/MER1_type. AC017084.8 contains 14bp more data than AC022201.4, join is also supported by fosmid end pairs pass   [email protected] AC018643 AC105443   other   62648bp overlap, AC105443.2 contains 15bp more on the end than AC018643.3, this is UWGC clone, we will contact them to see if this is possibly a vector issue. overlap supported by bac and fosmid end pairs in process   [email protected] AC018645 AC018648   sine repeatmasker Alu. 27084bp overlap, AC018648.5 contains 551bp more than AC018645.4 pass   [email protected] AC018678 AC062032 AC079297     another accession sequenced to confirm join pass   [email protected] AC018804 AC018865   other in progress 66488 bp overlap, multiple indels present, join is also supported by bac and fosmid end pairs return 12 bac-end and 16 fosmid-end links - is this overrepresentation? May require additional support eg. PCR [email protected] AC108938 AC112229   other repeatmasker LINE/L2, SINE/Alu, LTR/ERVL 88635 bp overlap, multiple indels-resulting in AC112229.4 containing 19bp more data than AC108938.3 return requires BAC, fosmid end support or other [email protected] AC106892 AC110798   sine polymorphic based on genomic pcr assay Alu. AC106892.3 contains 264bp msore data than AC110798.4, join supported by bac and fosmid end pairs, bp differences in the overlap were assayed and the overlap was found to be polymorphic pass   [email protected] AC107048 AC108164   sine polymorphic based on genomic pcr assay Alu. 78104 bp overlap, AC107048.3 contains 307bp, 304bp, 50bp, and 337bp more than AC108164.5, join supported by fosmid end pair, bp differences in the overlap were assayed and the overlap was found to be polymorphic pass   [email protected] AC107214 AC108477   sine polymorphic based on genomic pcr assay Alu. multiple indels present, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join supported by fosmid end pairs pass   [email protected] AC104809 AC112784   other polymorphic based on genomic pcr assay 14444 bp overlap, AC104809.5 contains 164bp more data than AC112784.4, join is also supported by bac and fosmid end pairs, bp differences in the overlap were assayed and the overlap was found to be polymorphic pass   [email protected] AC104068 AC104795   sine polymorphic based on genomic pcr assay Alu. AC104068.3 contains 305bp more data than AC104795.1, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join supported by bac and fosmid end pairs pass   [email protected] AC095041 AC108205   other polymorphic based on genomic pcr assay LINE/L1, DNA/MER1_type, LTR/ERVL. AC108205.5 contains 5796bp more data than AC095041.3, multiple indels also present, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join supported by bac and fosmid end pairs pass   [email protected] AC096576 AC107462   sine polymorphic based on genomic pcr assay AC096576.3 contains 190bp more data than AC107462.5, AC107462.5 contains 1885bp more data than AC096576.3, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join supported by bac and fosmid end pairs return Probably OK, but 17 BAC-ends - is this overrepresentation? [email protected] AC093164 AC104695   other polymorphic based on genomic pcr assay SINE/Alu, LINE/L1. indel present, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join is also supported by bac and fosmid end pairs pass   [email protected] AC097108 AC098870   other polymorphic based on genomic pcr assay indel present, join supported by bac and fosmid end pairs, bp differences in the overlap were assayed and the overlap was found to be polymorphic pass   [email protected] AC097526 AC107208   other polymorphic based on genomic pcr assay AC107208.6 contains 108bp more data than AC097526.3, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join supported by bac and fosmid end pairs pass   [email protected] AC093627 AC093666   line repeatmasker L1. 7p telomeric, 145213bp overlap, AC093627.4 contains 290bp and 32bp more than AC093666.4, join is also supported by bac and fosmid end pairs return possible over-representation of fosmid links (16). Please check and comment [email protected] AC093689 AC093771   other polymorphic based on genomic pcr assay AC093771.3 contains 198bp more data than AC093689.4, AC093689.4 contains 704bp more data than AC093771.3, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join supported by bac and fosmid end pairs pass   [email protected] AC093724 AC103564   other AC093724.2 will be resubmitted this clone previously had a misassembly in process Please return certificate if not resolved; otherwise should resolve with new compute [email protected] AC093860 AC108060 AC023350     another accession sequenced to confirm join pass   [email protected] AC092106 AC114755   other repeatmasker SINE/Alu, LTR/ERV1, LINE/L1. AC092106.5 contains 6350bp more data than AC114755.4, join is also supported by bac and fosmid end pairs pass This is at the edge of passing due to multiple variations. [email protected] AC092442 AC113615 AC004624     Minimal overlap finished, but AC004624 confirms overlap. Overlap also supported by BAC and fosmid end pairs. pass   [email protected] AC092463 AC106045   other polymorphic based on genomic pcr assay LTR/MaLR, SINE/Alu. AC106045.5 contains 2432bp more data than AC092463.5, AC092463.5 contains 488bp more data than AC106045.5, join supported by bac and fosmid end pairs, bp differences in the overlap were assayed and the overlap was found to be polymorphic pass 12 fosmid-ends - is this overrepresentation? [email protected] AC092619 AC113618   line polymorphic based on genomic pcr assay L1. AC113618.5 contains 1331bp more data than AC092619.3, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join is also supported by bac and fosmid end pairs pass 11 fosmid-ends - is this overrepresentation? [email protected] AC092628 AC099552   other polymorphic based on genomic pcr assay multiple indels, join is also supported by bac and fosmid end pairs, bp differences in the overlap were assayed and the overlap was found to be polymorphic pass 13 fosmid-end links - is this overrepresentation? [email protected] AC092683 AC099646 AC092683     no overlap was finished, but sequence from a previous accession version confirms overlap pass   [email protected] AC092685 AC104073   other polymorphic based on genomic pcr assay AC092685.2 contains 4099 bp more data than AC104073.3, bp differences in the overlap were assayed and the overlap was found to be polymorphic pass   [email protected] AC079255 AF093117 AC079255     no overlap was finished, but sequence from a previous accession version confirms overlap pass   [email protected] AC079402 AC079769   other in progress 2000 bp overlap, indel present due to simple repeat return requires BAC, fosmid end support or other; probably OK if this can be supplied [email protected] AC079837 AL133243   other ? we think this might be extra vector on AL133243.1, this is GS clone, we are clipping it back manually in the agp file. This join is supported by bac and fosmid end pairs in process Please return certificate when resolved; or, if extra vector, will resolve on next compute [email protected] AC006334 AC073330   sslp in progress AC073330.6 contains 721bp more than AC006334.3. Low complexity, simple repeats. Join is supported by both fosmid and bac end pairs return Greg`s site says over 20 kb difference, please investigate [email protected] AC006433 AC069288 AC069288     no overlap was finished, but sequence from a previous accession version confirms overlap pass   [email protected] AC006445 AC020729 AC020729     no overlap was finished, but sequence from a previous accession version confirms overlap pass   [email protected] AC006226 AC020729 AC020729     no overlap was finished, but sequence from a previous accession version confirms overlap pass   [email protected] AC006230 AC025539 AC025539     no overlap was finished, but sequence from a previous accession version confirms overlap pass   [email protected] AC004166 AC083884   sine william`s region - will not be tested Alu. AC004166.12 contains 179bp more than AC083884.6,join is also supported by bac and fosmid end pairs disputed 12 BAC- and 27 fosmid-ends -likely to be over-representation or complications due to William`s region. Since further work is not likely to be enlightening in the short term, this remains disputed. [email protected] AC004841 AC093799   other polymorphic based on genomic pcr assay AC093799.2 contains 791bp more than AC004841.2, join is also supported by bac and fosmid end pairs, bp differences in the overlap were assayed and the overlap was found to be polymorphic pass   [email protected] AC004936 AC010991 AC010991     no overlap was finished, but sequence from a previous accession version confirms overlap pass   [email protected] AC005015 AC005081   other polymorphic based on genomic pcr assay AC005015.2 contains 460bp more than AC005081.3, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join is also supported by bac and fosmid end pairs pass   [email protected] AC005056 AC005057 AC004956     Minimal overlap was finished, but AC004956 confirms overlap. Overlap also supported by BAC and fosmid end pairs. pass   [email protected] AC005061 AC099759   other polymorphic based on genomic pcr assay assayed base differences in both clones as well as the 1958 indel and found both to be polymorphic pass   [email protected] AC005072 AC005103 AC005072     no overlap was finished, but sequence from a previous accession version confirms overlap pass   [email protected] AC005086 AC005103   other polymorphic based on genomic pcr assay AC005103.3 contains 164 bp more than AC005086.2, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join is also supported by bac and fosmid end pairs pass   [email protected] AC005237 AC111201   other in progress 1986 bp overlap, AC111201.5 contains 13bp more data than AC005237.2 return requires BAC, fosmid end support or other [email protected] AC005326 AC079781   other polymorphic based on genomic pcr assay AC005326.2 contains 333bp more than AC079781.7, join is also supported by bac and fosmid end pairs, bp differences in the overlap were assayed and the overlap was found to be polymorphic pass   [email protected] AC005598 AC108063   sslp repeatmasker 1983 bp overlap, AC108063.3 contains 19bp more data than AC005598.6, join supported by bac and fosmid end pairs pass   [email protected] AC005674 AC108199   sine polymorphic based on genomic pcr assay Alu. 89047 bp overlap, AC108199.5 contains 232bp and 306bp more data than AC005674.11, join supported by fosmid end pairs, bp differences in the overlap were assayed and the overlap was found to be polymorphic pass   [email protected] AC005699 AC025539 AC025539     no overlap was finished, but sequence from a previous accession version confirms overlap pass   [email protected] AC003093 AC005084 AC084148     Minimal overlap was finished, but AC084148 confirms overlap. Overlap also supported by BAC and fosmid end pairs. pass   [email protected] AC002385 AC092465   other polymorphic based on genomic pcr assay AC002385.1 contains 6028 bp more than AC092465.5 , bp differences in the overlap were assayed and the overlap was found to be polymorphic, join is also supported by bac and fosmid end pairs pass   [email protected] AC004027 AC079799   other polymorphic based on genomic pcr assay bp differences in the overlap were assayed and the overlap was found to be polymorphic, join supported by bac and fosmid end pairs pass   [email protected] AC002088 AC002124 AC007555     Minimal overlap was finished, but AC007555 confirms overlap. Overlap also supported by BAC and fosmid end pairs. pass   [email protected] AC011893 AC016742 AC012551     another accession sequenced to confirm join pass   [email protected] AC011744 AC105415   sine polymorphic based on genomic pcr assay Alu. AC105415.2 contains 334bp more data than AC011744.8, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join supported by bac and fosmid end pairs return Almost certainly OK, but 16 fosmid-ends - is that overrepresentation? [email protected] AC011228 AC019210   other repeatmasker LTR/ERVL, LINE/L1. an indel is present in each accession at different places, 567bp more in AC011228.9, and 356 bp more in AC019210.7, supported by both fosmid and bac end pairs return Multiple with InDels, probably needs additional conmfirmation [email protected] AC010743 AL121654 AC010743     no overlap was finished, but sequence from a previous accession version confirms overlap pass   [email protected] AC010743 AL121657 AC010743     no overlap was finished, but sequence from a previous accession version confirms overlap pass   [email protected] AC010913 AC012366 AC073630     another accession sequenced to confirm join pass   [email protected] AC011005 AC083866   other repeatmasker SINE/Alu, LINE/L1. Indels present, join is also supported by bac and fosmid end pairs return Probably OK, but if indels are extensive requires additional support eg. PCR [email protected] AC011005 AC018639   sine repeatmasker Alu. AC011005.7 contains 673 bp more than AC018639.8, join is also supported by bac and fosmid end pairs pass   [email protected] AC012513 AC069155   other polymorphic based on genomic pcr assay AC012513.12 contains 2556bp more data than AC069155.6, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join is also supported by bac and fosmid end pairs pass   [email protected] AC013399 AC079988   other polymorphic based on genomic pcr assay SINE/Alu, LTR/MaLR. AC079988.6 contains 298bp more data than AC013399.6, AC013399.6 contains 606bp more data than AC079988.6, join is also supported by bac and fosmid end pairs, bp differences in the overlap were assayed and the overlap was found to be polymorphic pass   [email protected] AC013480 AC083949 AC013480     no overlap was finished, but sequence from a previous accession version confirms overlap pass   [email protected] AC013733 AC073977   sine polymorphic based on genomic pcr assay Alu. AC013733.10 contains 305bp more data than AC073977.6, join is also supported by bac and fosmid end pairs, bp differences in the overlap were assayed and the overlap was found to be polymorphic pass   [email protected] AC015976 AC114745   other polymorphic based on genomic pcr assay SINE/Alu, LINE/L1, DNA/MER1_type. 117889 bp overlap, AC015976.8 contains 8425bp more data than AC114745.6, join is also supported by bac and fosmid end pairs, bp differences in the overlap were assayed and the overlap was found to be polymorphic pass   [email protected] AC016692 AC064852   sine repeatmasker Alu. 2000 bp overlap, AC064852.4 contains 291bp more data than AC016692.9, join is also supported by bac and fosmid end pairs pass   [email protected] AC016711 AC023430 AC016711     no overlap was finished, but sequence from a previous accession version confirms overlap pass   [email protected] AC016759 AC107209   sine polymorphic based on genomic pcr assay Alu. AC107209.4 contains 316bp more data than AC016759.11, join is also supported by bac and fosmid end pairs, bp differences in the overlap were assayed and the overlap was found to be polymorphic pass   [email protected] AC006840 AC114736   line polymorphic based on genomic pcr assay L1. AC006840.17 contains 6085bp more data than AC114736.4, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join supported by bac and fosmid end pairs pass   [email protected] AC007073 AC113614   other polymorphic based on genomic pcr assay LTR/MaLR. AC113614.4 contains 548bp more data than AC007073.2, join supported by bac and fosmid end pairs, bp differences in the overlap were assayed and the overlap was found to be polymorphic pass   [email protected] AC007189 AC079394 AC079394     no overlap was finished, but sequence from a previous accession version confirms overlap pass   [email protected] AC008039 AC018662   sine repeatmasker Alu. AC008039.1 contains 301bp more than AC018662.3, join is also supported by bac and fosmid end pairs pass   [email protected] AC008122 AC019178 AC019178     no overlap was finished, but sequence from a previous accession version confirms overlap pass   [email protected] AC008122 AC013468 AC013468     no overlap was finished, but sequence from a previous accession version confirms overlap pass   [email protected] AC009264 AC009332   sslp repeatmasker AC009264.6 contains 295bp more than AC009332.6, join is also supported by bac and fosmid end pairs pass   [email protected] AC009274 AC016831   line repeatmasker L1. 24267bp overlap, AC009274.11 contains 1064bp more than AC016831.1 pass   [email protected] AC009958 AC110080   line to be tested indels in both accessions, will test to confirm overlap in process For a simple variation, BAC or fosmid end data likely sufficient to confirm. If compound or not a recent LINE, may be preferable to confirm variation by genomic PCR. [email protected] AC010095 AC073415   other polymorphic based on genomic pcr assay SINE/Alu, LINE/L1. AC010095.6 contains 1556bp more data than AC073415.6, join is also supported by bac and fosmid end pairs, bp differences in the overlap were assayed and the overlap was found to be polymorphic pass   [email protected] AC009332 AC108510   sslp repeatmasker AC108510.2 contains 339 bp more than AC009332.6, join is also supported by bac and fosmid end pairs pass   [email protected] AC009336 AC016739 AC016739     no overlap was finished, but sequence from a previous accession version confirms overlap pass   [email protected] AL121654 AL133247   line repeatmasker L1. 49041 bp overlap, AL133247.1 contains 1505bp more data than AL121654.1, join supported by bac and fosmid end pairs pass   [email protected] AL121656 AL133244   sine repeatmasker 28401 bp overlap, indel present return requires BAC, fosmid end support or other; if indel, may need PCR support [email protected] AL121796 AL590235   other repeatmasker LINE/L1, simple_repeat. 64378 bp overlap, multiple indels present- mostly due to a dinucleotide repeat return requires BAC, fosmid end support or other [email protected] AC016674 AC092169   line polymorphic based on genomic pcr assay L1. AC016674.9 contains 6039bp more data than AC092169.4, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join is also supported by bac and fosmid end pairs pass   [email protected] AC018678 AC069333 AC026337     another accession sequenced to confirm join pass   [email protected] AC018687 AF250324 AC018687     no overlap was finished, but sequence from a previous accession version confirms overlap pass   [email protected] AC097493 AC118279 AC118279     no overlap was finished, but sequence from a previous accession version confirms overlap pass   [email protected] AC107397 AC121155   none   this was a vector clipping problem, it has been fixed with AC107397.5 pass   [email protected] AC113607 AC116614   other polymorphic based on genomic pcr assay multiple indels, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join is also supported by bac and fosmid end pairs pass   [email protected] AC093898 AC121160   other polymorphic based on genomic pcr assay indel present, join supported by bac and fosmid end pairs, bp differences in the overlap were assayed and the overlap was found to be polymorphic pass   [email protected] AC019341 AC121161   line polymorphic based on genomic pcr assay L1. AC121161.2 contains 175bp more data than AC019341.6, join supported by bac and fosmid end pairs, bp differences in the overlap were assayed and the overlap was found to be polymorphic pass 12 fosmid-ends - is this overrepresentation? [email protected] AC104597 U66061   other polymorphic U66061.1 contains 10 kb more than AC104597.3, within the 10 kb is T Cell Receptor Beta Locus, NG_001333.1, join is also supported by bac and fosmid end pairs return 17 fosmid-ends - is this overrepresentation? May require additional support eg. PCR; may be intractable due to TCR locus; if so, `disputed` or `unresolved` [email protected] AC009961 AC093873 AC087594     another accession finished to confirm join pass   [email protected] AC105446 AC118759   other repeatmasker 1220 bp overlap; SINE/Alu; multiple indels in overlap, high number of substitutions, have fosmids picked in this area to confirm overlap return This is really an `other`; there is a SINE present, but also multiple other differences. Likely requires more than just BAC or fosmid support [email protected] AC099799 AC116176   other polymorphic based on genomic pcr assay AC116176.4 contains 189bp more data than AC099799.6, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join is also supported by bac and fosmid end pairs pass   [email protected] AC113607 AC116609   other polymorphic based on genomic pcr assay LINE/L1, SINE/Alu, LTR/MaLR. AC116609.6 contains 4152bp more data than AC113607.3, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join is also supported by bac and fosmid end pairs pass 13 fosmid end links---over-representation of fosmid-ends? Investigate. [email protected] AC114808 AC116614   other polymorphic based on genomic pcr assay 2ptelomeric region, indel in overlap, 200 bases more in AC114808.4, bp differences in the overlap were assayed and the overlap was found to be polymorphic pass   [email protected] AC108866 AC116647   line polymorphic based on genomic pcr assay L1. 2205 bp overlap, AC108866.5 contains 193bp more data than AC116647.4, join supported by fosmid end pair, bp differences in the overlap were assayed and the overlap was found to be polymorphic pass   [email protected] AC112227 AC125245   other polymorphic based on genomic pcr assay SINE/Alu, LINE/L1. AC112227.4 contains 639bp and 81bp more than AC125245.4, join supported by bac and fosmid end pairs, bp differences in the overlap were assayed and the overlap was found to be polymorphic pass   [email protected] AC112713 AC125333   other in progress 2217 bp overlap, AC112713.3 contains 122bp more data than AC125333.4 return requires BAC, fosmid end support or other [email protected] AC007249 AC007314 AC007314     no overlap was finished, but sequence from a previous accession version confirms overlap pass   [email protected] AC009411 AC018742 AC084349     another accession sequenced to confirm join pass   [email protected] AC012065 AC012361 AC023124     another accession sequenced to confirm join pass   [email protected] AC012003 AC012353 AC034171     another accession finished to confirm join pass   [email protected] AC092594 AC130814   other polymorphic, based on pcr assay AC130814.3 contains two copies of a 19kb region and AC092594.2 only contains one copy , we have assayed this overlap and found it to be polymorphic pass in future, helpful to include BAC or fosmid end sequence evidence in these cases. [email protected] AC068279 AC133644   other   not able to pcr due to repetative nature of clone unresolved Assuming that no further work is possible; there is BAC and fosmid end support. [email protected] AC130223 AC134873   other in progress We believe that AC130223 (telomeric cosmid from Harold Riethman) is deleted, but it extends out further towards the telomere, so we want to use a portion of the sequence. It will probably be clipped back. in process Please return certificate when resolved. [email protected] AC095038 AC118758   sine repeatmasker Alu. indel present, 2766bp overlap between AC095038.3 and AC118758.3, AC095038.3 contains 129bp more data than AC118758.3, join is supported by both fosmid and bac end pairs pass InDel should probably be confirmed [email protected] AC018696 AC116050   other repeatmasker SINE/Alu, Satellite, LTR/ERVL, LINE/L1, SINE/MIR, LTR/MaLR, LINE/L2. centromeric, multiple indels contained in overlap, entire overlap is 74kb, many fosmid and BAC links return clear overrepresentation of bac- and fosmid-ends. Investigate. requires additional support eg. PCR [email protected] AC010984 AC133785   other polymorphic based on genomic pcr assay LINE/L2, LTR/MaLR, SINE/MIR, SINE/Alu, LINE/L1. AC133785.2 contains 8243bp more data than AC010984.7, join is also supported by bac and fosmid end pairs, bp differences in the overlap were assayed and the overlap was found to be polymorphic pass   [email protected]